pMET7-GAG-HRAS
(Plasmid #80604)

• Purpose: Mammalian expression vector that expresses the HIV-1 GAG protein with HRAS fused to it
• Depositing Lab: Sven Eyckerman
• Publication: Eyckerman et al Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416.

Backbone

• Vector backbone: pMET7
• Backbone manufacturer: -
• Backbone size w/o insert (bp): 2967
• Total vector size (bp): 5050
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HIV-1 p55 GAG
• Alt name: GAG
• Species: HIV-1
• Insert Size (bp): 1500
• Promoter: SRalpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATCAAAGAACTGCTCCTC
• 3′ sequencing primer: GTAACCATTATAAGCTGCAA

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains a fusion insert (HIV-1 GAG and human HRAS). Researchers interested in using the system will need to replace the HRAS with their cDNA of interest. Note: The HRAS insert is missing aa 181-189 (stops at aa 180).