pCMV-deltaR8.2(A14C,E45C,A92E)
(Plasmid
#79048)
-
Purpose(Empty Backbone) mammalian expression, lentiviral packaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-deltaR8.2
- Backbone size (bp) 13457
-
Modifications to backboneGCC->TGC (1315-1317), GAA-> TGC (1408-1410), GCA->GAA (1549-1551) A14C/E45C/A92E mutations in the CA protein
-
Vector typeMammalian Expression, Lentiviral
- Promoter CMV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAGCACAGCAAGCAGCAGC
- 3′ sequencing primer GCTATGTGCCCTTCTTTGCCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCMV-deltaR8.2 was provided by Dr. Didier Trono and A14C/E45C/A92E mutations were introduced in CA by Quikchange
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene Sanger sequencing results found C-->A missense mutation at nucleotide #25 within the pol protein; this nucleotide may differ, however, in other reference sequences for gag-pol transframe domain
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-deltaR8.2(A14C,E45C,A92E) was a gift from Wesley Sundquist (Addgene plasmid # 79048 ; http://n2t.net/addgene:79048 ; RRID:Addgene_79048) -
For your References section:
Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068