-
PurposeLentiviral lncRNA Overexpression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLeGO-Cer
-
Backbone manufacturerKristoffer Ricken, Boris Fehse
- Backbone size w/o insert (bp) 8300
- Total vector size (bp) 8300
-
Modifications to backbonedelete mU6 promoter, insert cloning oligo with lncRNA MCS (PacI, SgsI), insert BGHpolyA, insert PGK promoter
-
Vector typeLentiviral
-
Selectable markersBlasticidin ; mCerulean
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameempty control
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer GAGCTCACAACCCCTCACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe LeGOlnc is a derivative of the LeGO-Cer/BSD, generated by Weber et al and as indicated for the LeGO-Cer (https://www.addgene.org/27351). Patents and licensing are also as indicated for LeGO-Cer (https://www.addgene.org/27351). The PGK-promoter was cloned from the MSCV-puro vector (Clonetech/Takara Bio).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The LeGO-Cer/BSD backbone was cut with XbaI and XhoI to remove the mouse U6 promoter. The linearized plasmid was blunted by a proof-read Polymerase and religated. The resulting LeGO-Cer-noU6 was cut with BamHI and the mouse phosphoglycerate kinase 1 promoter (PGK) -amplified from the MSCV-puro vector (Clonetech/Takara Bio) - was inserted in sense orientation to drive expression of the Cerulean-BSD cassette. An SV40 consensus polyadenylation signal (pA) with a PacI and a PstI site at the 3' end was gene synthesized and inserted into the NsiI site before the PGK promoter. The SFFV promoter from the LeGO-Cer backbone was removed by excision with NotI and PacI and a cloning oligo with an MCS for lncRNA insertion (5'-NotI->AanI->XmaJI->XhoI->XbaI->HpaI->PacI-3') was inserted with NotI and PacI. The SFFV fragment -amplified from LeGO-Cer- was reinserted into the NotI site to drive expression of the lnRNA-pA cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-lnc was a gift from Jan-Henning Klusmann (Addgene plasmid # 80624 ; http://n2t.net/addgene:80624 ; RRID:Addgene_80624) -
For your References section:
LincRNAs MONC and MIR100HG act as oncogenes in acute megakaryoblastic leukemia. Emmrich S, Streltsov A, Schmidt F, Thangapandi VR, Reinhardt D, Klusmann JH. Mol Cancer. 2014 Jul 15;13:171. doi: 10.1186/1476-4598-13-171. 10.1186/1476-4598-13-171 PubMed 25027842