pProm1_BCD1-GFP
(Plasmid
#80649)
-
PurposePromoter1 with BCD1-gfp
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
-
Backbone manufacturerN/A
- Total vector size (bp) 2353
-
Modifications to backbonen/a
-
Vector typep15A origin, constitutive promoter, KanR
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsMedium copy
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt namesfGFP
-
Insert Size (bp)717
-
MutationNONE
- Promoter constitutive promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer QB3284_Fwd CGATCCTCATCCTGTCTCTTGATC
- 3′ sequencing primer QB3810_Rev CGAGCGTAGCGAGTCAGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProm1_BCD1-GFP was a gift from Nathan Hillson (Addgene plasmid # 80649 ; http://n2t.net/addgene:80649 ; RRID:Addgene_80649) -
For your References section:
PR-PR: cross-platform laboratory automation system. Linshiz G, Stawski N, Goyal G, Bi C, Poust S, Sharma M, Mutalik V, Keasling JD, Hillson NJ. ACS Synth Biol. 2014 Aug 15;3(8):515-24. doi: 10.1021/sb4001728. Epub 2014 Jan 14. 10.1021/sb4001728 PubMed 25126893