pEN-L1-K2-L2
              
              
                (Plasmid
                
                #80684)
              
            
            
            
          - 
            PurposeGateway Entry vector containing a temperature-sensitive mouse DHFR
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDONR201
- 
              Backbone manufacturerinvitrogen
- 
              Vector typeMammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, Synthetic Biology
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert 1
- 
                Gene/Insert nameDHFR
- 
                    SpeciesM. musculus (mouse)
- 
                  Mutationmouse DHFR with N-terminal Ubiquitin
- 
                    GenBank IDNM_010049 NM_010049
- 
                        Entrez GeneDhfr (a.k.a. 8430436I03Rik)
- 
    
        Tag
        / Fusion Protein
    - 3xHA (C terminal on insert)
 
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer ctcgagctgcagaattactatttacaattaca
- 3′ sequencing primer AGCACCAGCACCAGCGTAATCTGGAACGTCGTATGGATA (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert nameDHFR
- 
                    SpeciesM. musculus (mouse), A. thaliana (mustard weed)
- 
                  Mutationmouse DHFR with N-terminal Ubiquitin
- 
                    GenBank IDNM_010049.3
- 
                        Entrez GeneDhfr (a.k.a. 8430436I03Rik)
- 
    
        Tag
        / Fusion Protein
    - 3xHA (C terminal on insert)
 
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ctcgagctgcagaattactatttacaattaca
- 3′ sequencing primer AGCACCAGCACCAGCGTAATCTGGAACGTCGTATGGATA (Common Sequencing Primers)
Resource Information
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pEN-L1-K2-L2 was a gift from Nico Dissmeyer (Addgene plasmid # 80684 ; http://n2t.net/addgene:80684 ; RRID:Addgene_80684)
- 
                For your References section: Phenotypes on demand via switchable target protein degradation in multicellular organisms. Faden F, Ramezani T, Mielke S, Almudi I, Nairz K, Froehlich MS, Hockendorff J, Brandt W, Hoehenwarter W, Dohmen RJ, Schnittger A, Dissmeyer N. Nat Commun. 2016 Jul 22;7:12202. doi: 10.1038/ncomms12202. 10.1038/ncomms12202 PubMed 27447739
