pESC-NAT-LACap
(Plasmid
#80763)
-
PurposeExpresses truncated L-A capsid for curing satellite virus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepESC-LEU
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 7800
- Total vector size (bp) 9996
-
Modifications to backboneLEU2 cassette replaced by NAT-resistance cassette from pAG25 by short homology directed in vivo replacement.
-
Vector typeYeast Expression
-
Selectable markersNAT (select with Nourseothricin/clonNAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL-A cDNA (L-A Cap)
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2072
- Promoter PGK1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cattcatataactccccatgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For information on L-A cDNA and its effect on curing of L-A, refer to the following papers:
JOURNAL OF VIROLOGY, Jan. 1991, p. 155-161
JOURNAL OF VIROLOGY, June 1992, p. 3669-3676
JOURNAL OF VIROLOGY, May 1993, P. 2764-2771
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pESC-NAT-LACap was a gift from John McCusker (Addgene plasmid # 80763 ; http://n2t.net/addgene:80763 ; RRID:Addgene_80763)