Skip to main content

AAVS1-Pur-CAG-mCherry
(Plasmid #80946)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80946 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAVS1
  • Backbone size w/o insert (bp) 10247
  • Total vector size (bp) 10958
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    711
  • Promoter CAG promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer ggcttctggcgtgtgaccggc
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The mCherry was amplified from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (addgene #44362)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Pur-CAG-mCherry was a gift from Su-Chun Zhang (Addgene plasmid # 80946 ; http://n2t.net/addgene:80946 ; RRID:Addgene_80946)
  • For your References section:

    Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson's Disease. Chen Y, Xiong M, Dong Y, Haberman A, Cao J, Liu H, Zhou W, Zhang SC. Cell Stem Cell. 2016 Jun 2;18(6):817-26. doi: 10.1016/j.stem.2016.03.014. Epub 2016 Apr 28. 10.1016/j.stem.2016.03.014 PubMed 27133795