Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTriEx-mCherry-LOV2 V416L
(Plasmid #81036)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 81036 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTriEx
  • Backbone size w/o insert (bp) 5040
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOV V416L
  • Species
    Synthetic
  • Insert Size (bp)
    432
  • Mutation
    V416L
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer aagtatcgggccctttgtgc
  • 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEx-mCherry-LOV2 V416L was a gift from Klaus Hahn (Addgene plasmid # 81036 ; http://n2t.net/addgene:81036 ; RRID:Addgene_81036)
  • For your References section:

    LOVTRAP: an optogenetic system for photoinduced protein dissociation. Wang H, Vilela M, Winkler A, Tarnawski M, Schlichting I, Yumerefendi H, Kuhlman B, Liu R, Danuser G, Hahn KM. Nat Methods. 2016 Jul 18. doi: 10.1038/nmeth.3926. 10.1038/nmeth.3926 PubMed 27427858