pTriEx-mCherry-LOV2 I427V
(Plasmid
#81044)
-
Purposemammalian expression of LOV2 I427V
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5040
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOV I427V
-
SpeciesSynthetic
-
Insert Size (bp)543
-
MutationI427V
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-mCherry-LOV2 I427V was a gift from Klaus Hahn (Addgene plasmid # 81044 ; http://n2t.net/addgene:81044 ; RRID:Addgene_81044) -
For your References section:
LOVTRAP: an optogenetic system for photoinduced protein dissociation. Wang H, Vilela M, Winkler A, Tarnawski M, Schlichting I, Yumerefendi H, Kuhlman B, Liu R, Danuser G, Hahn KM. Nat Methods. 2016 Jul 18. doi: 10.1038/nmeth.3926. 10.1038/nmeth.3926 PubMed 27427858