-
Purposebacterial expression of human LIG3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4T-3
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 7766
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA ligase 3
-
SpeciesH. sapiens (human)
-
GenBank IDNM_002311.4
-
Entrez GeneLIG3 (a.k.a. LIG2, LIG3alpha, MTDPS20)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAGCAAGTATATAGCATGG
- 3′ sequencing primer GAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T-hLIG3 was a gift from Primo Schaer (Addgene plasmid # 81055 ; http://n2t.net/addgene:81055 ; RRID:Addgene_81055) -
For your References section:
Biochemical reconstitution of TET1-TDG-BER-dependent active DNA demethylation reveals a highly coordinated mechanism. Weber AR, Krawczyk C, Robertson AB, Kusnierczyk A, Vagbo CB, Schuermann D, Klungland A, Schar P. Nat Commun. 2016 Mar 2;7:10806. doi: 10.1038/ncomms10806. 10.1038/ncomms10806 PubMed 26932196