-
Purpose(Empty Backbone) Lentiviral vector for constitutive gene expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN174-MCS
-
Backbone manufacturerHomemade
- Backbone size (bp) 8653
-
Modifications to backboneReplaced neomycin with puromycin.
-
Vector typeMammalian Expression, Lentiviral
- Promoter EF-1α
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N174-MCS (Puro) was a gift from Adam Karpf (Addgene plasmid # 81068 ; http://n2t.net/addgene:81068 ; RRID:Addgene_81068)