pGinB-8X(GGS)-dCas9-FLAG-NLS_SpecR
(Plasmid
#81206)
-
PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminus. Spec resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 8000
-
Modifications to backboneSpec resistance
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepGinB-8X(GGS)-dCas9-FLAG-NLS
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GinB derived from Barbas and coworkers:
T. Gaj, A. C. Mercer, S. J. Sirk, H. L. Smith, C. F. Barbas, A comprehensive approach to zinc-finger recombinase customization enables genomic targeting in human cells. Nucleic acids research 41, 3937-3946 (2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGinB-8X(GGS)-dCas9-FLAG-NLS_SpecR was a gift from David Liu (Addgene plasmid # 81206 ; http://n2t.net/addgene:81206 ; RRID:Addgene_81206) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511