pHU6_chr12_FAM19A2-down-gRNA-for
(Plasmid
#81223)
-
PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the downstream region of FAM19A2 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHU6
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 2200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6 expression of gRNA
-
gRNA/shRNA sequenceCh12 psuedo gix site at FAM19A2 locus, 62112594
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAAAAAGCACCGACTCGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHU6_chr12_FAM19A2-down-gRNA-for was a gift from David Liu (Addgene plasmid # 81223 ; http://n2t.net/addgene:81223 ; RRID:Addgene_81223) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511