pLKO.1 puro-humanU6-shRNA FASN
(Plasmid #82327)

• Purpose: used to silence target human FASN expression via RNA interference (3rd gen lentiviral vector)
• Depositing Lab: Elizabeth Stoll
• Publication: Elizabeth Stoll plasmids (unpublished)

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 7085
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: shRNA to target Fatty Acid Synthase (FASN)
• gRNA/shRNA sequence: Cacaccggtcgagagcacctttgatgacatctcgagatgtcatcaaaggtgctctcgtttttgaattccat
• Species: H. sapiens (human)
• GenBank ID: AY451392
• Entrez Gene: FASN (a.k.a. FAS, OA-519, SDR27X1)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: LKO.1 5'
• 3′ sequencing primer: GGACTATCATATGCTTACCGTAACTTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was created from Addgene scramble shRNA Plasmid #1864