TU#1805_CRISPR_unc-73_exon2
(Plasmid
#82359)
-
Purposeto create unc-73B null allele
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerBob Goldstein (Addgene plasmid # 47549)
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9 and sgRNA against unc-73 exon2
-
gRNA/shRNA sequenceATTCTGCATGTTCTTCGTGACGG
-
SpeciesC. elegans (nematode)
-
Entrez Geneunc-73 (a.k.a. CELE_F55C7.7)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer MoCloR (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TU#1805_CRISPR_unc-73_exon2 was a gift from Martin Chalfie (Addgene plasmid # 82359 ; http://n2t.net/addgene:82359 ; RRID:Addgene_82359) -
For your References section:
GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Zheng C, Diaz-Cuadros M, Chalfie M. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6. 10.1073/pnas.1607179113 PubMed 27274054