FSW-HRP-V5-MDGA2
(Plasmid
#82542)
-
PurposeLentiviral vector for expressing HRP-MDGA2 in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFSW
- Backbone size w/o insert (bp) 9540
- Total vector size (bp) 12336
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMDGA2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2796
-
Entrez GeneMdga2 (a.k.a. Mamdc1)
- Promoter Human Synapsin
-
Tags
/ Fusion Proteins
- HRP (N terminal on insert)
- V5 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGCGAGATAGGGGGGCACGGGCGCGAC
- 3′ sequencing primer gcgtaaaaggagcaacatagttaagaataccagtcaatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FSW-HRP-V5-MDGA2 was a gift from Alice Ting (Addgene plasmid # 82542 ; http://n2t.net/addgene:82542 ; RRID:Addgene_82542) -
For your References section:
Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Loh KH, Stawski PS, Draycott AS, Udeshi ND, Lehrman EK, Wilton DK, Svinkina T, Deerinck TJ, Ellisman MH, Stevens B, Carr SA, Ting AY. Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041. 10.1016/j.cell.2016.07.041 PubMed 27565350