FSW-HRP-V5-NLGN2
(Plasmid
#82545)
-
PurposeOverexpression vector for V5-NLGN2 in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFSW
- Backbone size w/o insert (bp) 9603
- Total vector size (bp) 12072
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNLGN2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2469
-
Entrez GeneNlgn2
- Promoter Human Synapsin
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- HRP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AscI (unknown if destroyed)
- 5′ sequencing primer GCGCTGCGGCGCCGGCGACTCAGCG
- 3′ sequencing primer catagttaagaataccagtcaatctttcac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FSW-HRP-V5-NLGN2 was a gift from Alice Ting (Addgene plasmid # 82545 ; http://n2t.net/addgene:82545 ; RRID:Addgene_82545) -
For your References section:
Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Loh KH, Stawski PS, Draycott AS, Udeshi ND, Lehrman EK, Wilton DK, Svinkina T, Deerinck TJ, Ellisman MH, Stevens B, Carr SA, Ting AY. Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041. 10.1016/j.cell.2016.07.041 PubMed 27565350