Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FSW-HRP-V5-NLGN2
(Plasmid #82545)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82545 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FSW
  • Backbone size w/o insert (bp) 9603
  • Total vector size (bp) 12072
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NLGN2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2469
  • Entrez Gene
    Nlgn2
  • Promoter Human Synapsin
  • Tags / Fusion Proteins
    • V5 (N terminal on insert)
    • HRP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AscI (unknown if destroyed)
  • 5′ sequencing primer GCGCTGCGGCGCCGGCGACTCAGCG
  • 3′ sequencing primer catagttaagaataccagtcaatctttcac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FSW-HRP-V5-NLGN2 was a gift from Alice Ting (Addgene plasmid # 82545 ; http://n2t.net/addgene:82545 ; RRID:Addgene_82545)
  • For your References section:

    Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Loh KH, Stawski PS, Draycott AS, Udeshi ND, Lehrman EK, Wilton DK, Svinkina T, Deerinck TJ, Ellisman MH, Stevens B, Carr SA, Ting AY. Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041. 10.1016/j.cell.2016.07.041 PubMed 27565350