Skip to main content

pET_mNG2(1-10)_32aalinker_mNG2(11)
(Plasmid #82611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82611 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5296
  • Total vector size (bp) 6082
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    use BL21 or similar for protein expression. induce protein expression by IPTG
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen2(1-10)_32aalinker_mNeonGreen2(11)
  • Species
    Synthetic
  • Insert Size (bp)
    786
  • Mutation
    split before mutations
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTCAAGACCCGTTTAGAGGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In the mNG2(1-10) fragment, mutations are K128M, S142T, R150M, G172V and K213M; in the mNG2(11) fragment, mutation is V15M.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_mNG2(1-10)_32aalinker_mNG2(11) was a gift from Bo Huang (Addgene plasmid # 82611 ; http://n2t.net/addgene:82611 ; RRID:Addgene_82611)
  • For your References section:

    Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864