-
PurposeBacterial expression vector for split sfCherry3 screening. The “sfCherry2(1-10)” and “sfCherry2(11)-SpyCatcher002” are expressed from two different T7 promoters.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETDuet-1
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 6551
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesfCherry2(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)621
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGAGATATACCATGGAGGAGGACAACATGG
- 3′ sequencing primer TGGCTGCTGCCCATGTCAGTCCTCGTTGTGGCTGGTGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesfCherry2(11)-SpyCatcher002
-
SpeciesSynthetic
-
Insert Size (bp)498
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AAGGAGATATACATAATGTACACCATCGTGGAGCAG
- 3′ sequencing primer TTGAGATCTGCCATAttaaatatgagcgtcacctttagttgctttgcca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/454041v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet_sfCherry2(1-10)_sfCherry2(11)-SpyCatcher was a gift from Bo Huang (Addgene plasmid # 117656 ; http://n2t.net/addgene:117656 ; RRID:Addgene_117656) -
For your References section:
Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, Zhou S, Ali N, Muller JD, Van Hoven MK, Huang B. Commun Biol. 2019 Sep 17;2:344. doi: 10.1038/s42003-019-0589-x. eCollection 2019. 10.1038/s42003-019-0589-x PubMed 31552297