pEGFP_sfCherry2(11)_zyxin
(Plasmid
#83034)
-
PurposeExpresses sfCherry2(11) tagged zyxin (human) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-mEmerald-Zyxin-6
-
Backbone manufacturerMichael Davidson Fluorescent Protein Collection at the UCSF Nikon Imaging center
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 5500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfCherry2(11)_zyxin
-
SpeciesSynthetic
-
Insert Size (bp)1788
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGAGCTCAAGCTTCGAATTC
- 3′ sequencing primer TATGATCTAGAGTCGCGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP_sfCherry2(11)_zyxin was a gift from Bo Huang (Addgene plasmid # 83034 ; http://n2t.net/addgene:83034 ; RRID:Addgene_83034) -
For your References section:
Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864