DH10B E. coli aptI/gidB::Landing Pad
(Bacterial strain
#83036)
-
PurposeFor site-specific chromosomal insertion of a target DNA sequence at an engineered landing pad site in the atpI/gidB locus.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 83036 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backbonenone
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B E. coli aptI/gidB::Landing Pad
-
Growth instructionsTetracycline 12.5 ug/ml
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenone
- Promoter none
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atpI/gidB F: CAGTAACTGAACGAGCAGAAG
- 3′ sequencing primer atpI/gidB R: CTTCGTCAGGTGCAACATGAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Precursor strain: ElectroMAX DH10B E. coli cells
Landing pad cassette at at the aptI/gidB locus includes in this order: I-SceI restriction site - Landing Pad 1 (LP1) sequence - tetA gene - Landing Pad 2 (LP2) sequence - I-SceI restriction site.
This strain was made based on the technology described in the Kulman and Cox 2010 Nucleic Acids Res. paper: Site-specific chromosomal integration of large synthetic constructs. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2847246/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DH10B E. coli aptI/gidB::Landing Pad was a gift from Cammie Lesser (Addgene plasmid # 83036) -
For your References section:
Engineering Escherichia coli into a protein delivery system for mammalian cells. Reeves AZ, Spears WE, Du J, Tan KY, Wagers AJ, Lesser CF. ACS Synth Biol. 2015 May 15;4(5):644-54. doi: 10.1021/acssynbio.5b00002. Epub 2015 Apr 24. 10.1021/acssynbio.5b00002 PubMed 25853840