pCaRNA3
(Plasmid
#86088)
-
PurposeExpression of cDNA of full-length genomic RNA3 of PNRSV (Pch12 isolate) in transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCass4Rz
-
Backbone manufacturerDr. Rao (University of California at Riverside)
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 13000
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNA3
-
SpeciesPrunus necrotic ringspot virus
-
Insert Size (bp)1900
-
GenBank IDJN416776 JN416776.1
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pst I (destroyed during cloning)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer GTACATAAACGAGGAATACT
- 3′ sequencing primer CTGTCTAGGAAGGGGTTCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCaRNA3 was a gift from Aiming Wang (Addgene plasmid # 86088 ; http://n2t.net/addgene:86088 ; RRID:Addgene_86088) -
For your References section:
An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Cui H, Wang A. Plant Biotechnol J. 2016 Aug 27. doi: 10.1111/pbi.12629. 10.1111/pbi.12629 PubMed 27565765