Skip to main content

pCaRNA3
(Plasmid #86088)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86088 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCass4Rz
  • Backbone manufacturer
    Dr. Rao (University of California at Riverside)
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 13000
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNA3
  • Species
    Prunus necrotic ringspot virus
  • Insert Size (bp)
    1900
  • GenBank ID
    JN416776 JN416776.1
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pst I (destroyed during cloning)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer GTACATAAACGAGGAATACT
  • 3′ sequencing primer CTGTCTAGGAAGGGGTTCTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCaRNA3 was a gift from Aiming Wang (Addgene plasmid # 86088 ; http://n2t.net/addgene:86088 ; RRID:Addgene_86088)
  • For your References section:

    An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Cui H, Wang A. Plant Biotechnol J. 2016 Aug 27. doi: 10.1111/pbi.12629. 10.1111/pbi.12629 PubMed 27565765