pCaRNA3-eIFiso4E120(+)
(Plasmid
#86092)
-
PurposeThis vector is used to specifically silence the eIF(iso)4E gene in peach via VIGS.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCass4Rz
-
Backbone manufacturerDr. Rao (University of California at Riverside)
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 11120
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeIFiso4E
-
Speciespeach (Prunus persica)
-
Insert Size (bp)120
-
GenBank IDppa011357m ppa011357m
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer CTTGTGGGGCCCACTGCTCGGCTGT
- 3′ sequencing primer ATGGCGACAGAGGTAGCAGCAGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCaRNA3-eIFiso4E120(+) was a gift from Aiming Wang (Addgene plasmid # 86092 ; http://n2t.net/addgene:86092 ; RRID:Addgene_86092) -
For your References section:
An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Cui H, Wang A. Plant Biotechnol J. 2016 Aug 27. doi: 10.1111/pbi.12629. 10.1111/pbi.12629 PubMed 27565765