TET-pLKO.1 PURO shSMAD4 #2
(Plasmid
#83091)
-
PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83091 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTet-pLKO-puro
-
Backbone manufacturerAddgene #21915
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8816
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshSMAD4
-
gRNA/shRNA sequenceGCAGACAGAAACTGGATTAAA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005359
-
Entrez GeneSMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The targeting sequence was identified from the TRC (TRCN0000288653). Potently knocks down SMAD4 expression after 3 x 500 uL lentiviral infection in MDA-MB-231 cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TET-pLKO.1 PURO shSMAD4 #2 was a gift from Kevin Janes (Addgene plasmid # 83091 ; http://n2t.net/addgene:83091 ; RRID:Addgene_83091) -
For your References section:
Tumor-Suppressor Inactivation of GDF11 Occurs by Precursor Sequestration in Triple-Negative Breast Cancer. Bajikar SS, Wang CC, Borten MA, Pereira EJ, Atkins KA, Janes KA. Dev Cell. 2017 Nov 20;43(4):418-435.e13. doi: 10.1016/j.devcel.2017.10.027. 10.1016/j.devcel.2017.10.027 PubMed 29161592