-
PurposeMouse Rab21 (wild type)
-
Depositing Lab
-
Depositing OrganizationUniversity of Turku
Located in Finland -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83421 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 83421-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 83421-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4681
- Total vector size (bp) 5358
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab21
-
Alt nameMus musculus RAB21, member RAS oncogene family (Rab21)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)677
-
GenBank IDNM_024454.1
-
Entrez GeneRab21 (a.k.a. 9630024B22)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 83421-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 83421-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Rab21 was a gift from Johanna Ivaska (Addgene plasmid # 83421 ; http://n2t.net/addgene:83421 ; RRID:Addgene_83421) -
For your References section:
Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of beta1-integrins. Pellinen T, Arjonen A, Vuoriluoto K, Kallio K, Fransen JA, Ivaska J. J Cell Biol. 2006 Jun 5;173(5):767-80. 10.1083/jcb.200509019 PubMed 16754960