-
PurposeExpresses GFP-C9orf72 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C2
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC9orf72
-
SpeciesH. sapiens (human)
-
Entrez GeneC9orf72 (a.k.a. ALSFTD, DENND9, DENNL72, FTDALS, FTDALS1)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C9orf72 was a gift from Shawn Ferguson (Addgene plasmid # 83437 ; http://n2t.net/addgene:83437 ; RRID:Addgene_83437) -
For your References section:
C9orf72 binds SMCR8, localizes to lysosomes and regulates mTORC1 signaling. Amick J, Roczniak-Ferguson A, Ferguson SM. Mol Biol Cell. 2016 Aug 24. pii: mbc.E16-01-0003. 10.1091/mbc.E16-01-0003 PubMed 27559131