ptdTomato-SMCR8
(Plasmid
#83438)
-
PurposeExpresses SMCR8-tdTomato in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneptdTomato-N1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHuman SMCR8
-
SpeciesH. sapiens (human)
-
Entrez GeneSMCR8
- Promoter CMV
-
Tag
/ Fusion Protein
- tdTomato (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptdTomato-SMCR8 was a gift from Shawn Ferguson (Addgene plasmid # 83438 ; http://n2t.net/addgene:83438 ; RRID:Addgene_83438) -
For your References section:
C9orf72 binds SMCR8, localizes to lysosomes and regulates mTORC1 signaling. Amick J, Roczniak-Ferguson A, Ferguson SM. Mol Biol Cell. 2016 Aug 24. pii: mbc.E16-01-0003. 10.1091/mbc.E16-01-0003 PubMed 27559131