pSpCas9(BB)-2A-Puro-C9orf72
(Plasmid
#83439)
-
PurposeExpresses Cas9 and a gRNA targeting C9orf72
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 62988)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting human C9orf72
-
gRNA/shRNA sequenceGCTTACTGGGACAATATTCT
-
SpeciesH. sapiens (human)
-
Entrez GeneC9orf72 (a.k.a. ALSFTD, DENND9, DENNL72, FTDALS, FTDALS1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Puro-C9orf72 was a gift from Shawn Ferguson (Addgene plasmid # 83439 ; http://n2t.net/addgene:83439 ; RRID:Addgene_83439) -
For your References section:
C9orf72 binds SMCR8, localizes to lysosomes and regulates mTORC1 signaling. Amick J, Roczniak-Ferguson A, Ferguson SM. Mol Biol Cell. 2016 Aug 24. pii: mbc.E16-01-0003. 10.1091/mbc.E16-01-0003 PubMed 27559131