Skip to main content
Addgene

pLEX_307-SOD1E133Δ
(Plasmid #83445)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83445 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEX_307 (plasmid #41392)
  • Backbone manufacturer
    David Root
  • Backbone size w/o insert (bp) 10065
  • Total vector size (bp) 8767
  • Modifications to backbone
    Removal of gateway cloning cassette and V5 tag
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    No longer than 16 hours culture.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    720
  • Mutation
    E133Δ
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter EF-1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer EF-1α_F
  • 3′ sequencing primer WPRE_R
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mohan Babu lab (pSOD1E133Δ-AcGFP1, #83419)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX_307-SOD1E133Δ was a gift from Mohan Babu (Addgene plasmid # 83445 ; http://n2t.net/addgene:83445 ; RRID:Addgene_83445)
  • For your References section:

    A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334