Skip to main content
Addgene

pLentiCRISPRv1-sgAAVS1
(Plasmid #83906)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83906 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv1
  • Backbone size w/o insert (bp) 11565
  • Total vector size (bp) 11589
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    adeno-associated virus integration site 1
  • Alt name
    AAVS1
  • gRNA/shRNA sequence
    CACCGGGGCCACTAGGGACAGGAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    AAVS1 (a.k.a. AAV)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1-sgAAVS1 was a gift from David Sabatini (Addgene plasmid # 83906 ; http://n2t.net/addgene:83906 ; RRID:Addgene_83906)
  • For your References section:

    A PHGDH inhibitor reveals coordination of serine synthesis and one-carbon unit fate. Pacold ME, Brimacombe KR, Chan SH, Rohde JM, Lewis CA, Swier LJ, Possemato R, Chen WW, Sullivan LB, Fiske BP, Cho S, Freinkman E, Birsoy K, Abu-Remaileh M, Shaul YD, Liu CM, Zhou M, Koh MJ, Chung H, Davidson SM, Luengo A, Wang AQ, Xu X, Yasgar A, Liu L, Rai G, Westover KD, Vander Heiden MG, Shen M, Gray NS, Boxer MB, Sabatini DM. Nat Chem Biol. 2016 Jun;12(6):452-8. doi: 10.1038/nchembio.2070. Epub 2016 Apr 25. 10.1038/nchembio.2070 PubMed 27110680