pLenti-sgCTRL-3
(Plasmid
#83936)
-
PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti-sgRNA
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgCTRL-3
-
gRNA/shRNA sequenceGTCGAAGTACTCGTTAAATG
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CATATACGATACAAGGCTGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-sgCTRL-3 was a gift from David Sabatini (Addgene plasmid # 83936 ; http://n2t.net/addgene:83936 ; RRID:Addgene_83936) -
For your References section:
A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors. Park RJ, Wang T, Koundakjian D, Hultquist JF, Lamothe-Molina P, Monel B, Schumann K, Yu H, Krupzcak KM, Garcia-Beltran W, Piechocka-Trocha A, Krogan NJ, Marson A, Sabatini DM, Lander ES, Hacohen N, Walker BD. Nat Genet. 2016 Dec 19. doi: 10.1038/ng.3741. 10.1038/ng.3741 PubMed 27992415