pRKB134_GI-DUX4-intron2(-)
(Plasmid
#83968)
-
Purposeto test DUX4 mRNA is subjected to NMD upon intron2 inclusion
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneβ-globin NMD reporter wild-type
-
Backbone manufacturerLynne Maquat, PMID 9671053
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDUX4-3'UTR-intron2(-)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)597
-
GenBank IDFJ439133.1
-
Entrez GeneDUX4 (a.k.a. DUX4L)
- Promoter mouseCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGGCTCACAAGTACCACTAG
- 3′ sequencing primer AGCATAAACCCTTCTATGACACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRKB134_GI-DUX4-intron2(-) was a gift from Robert Bradley (Addgene plasmid # 83968 ; http://n2t.net/addgene:83968 ; RRID:Addgene_83968) -
For your References section:
A feedback loop between nonsense-mediated decay and the retrogene DUX4 in facioscapulohumeral muscular dystrophy. Feng Q, Snider L, Jagannathan S, Tawil R, van der Maarel SM, Tapscott SJ, Bradley RK. Elife. 2015 Jan 7;4. doi: 10.7554/eLife.04996. 10.7554/eLife.04996 PubMed 25564732