pRF+423Dux4
(Plasmid
#21625)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 21625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRF
- Backbone size w/o insert (bp) 6518
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDouble homeobox, chr 4
-
Alt nameDux4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)423
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer GCAAGAAGATGCACCTGATG
- 3′ sequencing primer AGGAACCAGGGCGTATCTCT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRF+423Dux4 was a gift from Stephen Tapscott (Addgene plasmid # 21625 ; http://n2t.net/addgene:21625 ; RRID:Addgene_21625) -
For your References section:
RNA Transcripts, miRNA-sized Fragments, and Proteins Produced from D4Z4 Units: New Candidates for the Pathophysiology of Facioscapulohumeral Dystrophy. Snider L, Asawachaicharn A, Tyler AE, Geng LN, Petek LM, Maves L, Miller DG, Lemmers RJ, Winokur ST, Tawil R, van der Maarel SM, Filippova GN, Tapscott SJ. Hum Mol Genet. 2009 Apr 9. ():. 10.1093/hmg/ddp180 PubMed 19359275
Map uploaded by the depositor.
