Skip to main content

pUB6_EZH2
(Plasmid #84014)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84014 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUB6/V5-HisA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 9268
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EZH2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1811
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Promoter UB6

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAGTGTTAGACTAGTAAAT
  • 3′ sequencing primer TCGAAGGGCCCTCTAGACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB6_EZH2 was a gift from Robert Bradley (Addgene plasmid # 84014 ; http://n2t.net/addgene:84014 ; RRID:Addgene_84014)
  • For your References section:

    SRSF2 Mutations Contribute to Myelodysplasia by Mutant-Specific Effects on Exon Recognition. Kim E, Ilagan JO, Liang Y, Daubner GM, Lee SC, Ramakrishnan A, Li Y, Chung YR, Micol JB, Murphy ME, Cho H, Kim MK, Zebari AS, Aumann S, Park CY, Buonamici S, Smith PG, Deeg HJ, Lobry C, Aifantis I, Modis Y, Allain FH, Halene S, Bradley RK, Abdel-Wahab O. Cancer Cell. 2015 May 11;27(5):617-30. doi: 10.1016/j.ccell.2015.04.006. 10.1016/j.ccell.2015.04.006 PubMed 25965569