pRRL_SRSF2_P95L_mCherry
(Plasmid
#84022)
-
Purposeexpression of SRSF2 mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK-GFP.WPRE
-
Backbone manufacturerDidier Trono (Addgene plasmid # 12252)
- Backbone size w/o insert (bp) 6651
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSRSF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1458
-
MutationP95L
-
Entrez GeneSRSF2 (a.k.a. PR264, SC-35, SC35, SFRS2, SFRS2A, SRp30b)
- Promoter PGK
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- 2TA-mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggggttggggttgcgccttt (hPGK)
- 3′ sequencing primer TTACTTGTACAGCTCGTCCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAravind Ramakrishnan, FHCRC clinical research division
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL_SRSF2_P95L_mCherry was a gift from Robert Bradley (Addgene plasmid # 84022 ; http://n2t.net/addgene:84022 ; RRID:Addgene_84022) -
For your References section:
SRSF2 Mutations Contribute to Myelodysplasia by Mutant-Specific Effects on Exon Recognition. Kim E, Ilagan JO, Liang Y, Daubner GM, Lee SC, Ramakrishnan A, Li Y, Chung YR, Micol JB, Murphy ME, Cho H, Kim MK, Zebari AS, Aumann S, Park CY, Buonamici S, Smith PG, Deeg HJ, Lobry C, Aifantis I, Modis Y, Allain FH, Halene S, Bradley RK, Abdel-Wahab O. Cancer Cell. 2015 May 11;27(5):617-30. doi: 10.1016/j.ccell.2015.04.006. 10.1016/j.ccell.2015.04.006 PubMed 25965569