Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHD157
(Plasmid #84033)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84033 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cre
  • Promoter fabp10
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Venus
  • Promoter Crystalin

Cloning Information for Gene/Insert 2

Resource Information

  • Supplemental Documents

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Designed in a pBluescript series vector containing I-SceI meganuclease sites. The I-SceI meganuclease method is a common method for establishing transgenic zebrafish lines.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD157 was a gift from Daniel Hesselson & Didier Stainier (Addgene plasmid # 84033 ; http://n2t.net/addgene:84033 ; RRID:Addgene_84033)
  • For your References section:

    Conditional control of gene function by an invertible gene trap in zebrafish. Ni TT, Lu J, Zhu M, Maddison LA, Boyd KL, Huskey L, Ju B, Hesselson D, Zhong TP, Page-McCaw PS, Stainier DY, Chen W. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15389-94. Epub 2012 Aug 20. 10.1073/pnas.1206131109 PubMed 22908272