pDEW8
(Plasmid
#84238)
-
PurposePlasmid containing a P2A peptide (porcine teschovirus-1 derived) sequence that works efficiently in Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep413GPD
- Backbone size w/o insert (bp) 5771
- Total vector size (bp) 7372
-
Modifications to backboneInsertion of HA-mRuby-p2A-eGFP by gibson cloning
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-mRuby-P2A-eGFP
-
SpeciesSynthetic
-
Insert Size (bp)1601
- Promoter GPD
-
Tags
/ Fusion Proteins
- HA-mRuby (N terminal on insert)
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCAATTAACCCTCACTAAA
- 3′ sequencing primer AGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymRuby original source was p44888 eGFP original source was p44836
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEW8 was a gift from David Weinberg (Addgene plasmid # 84238 ; http://n2t.net/addgene:84238 ; RRID:Addgene_84238) -
For your References section:
The fail-safe mechanism of post-transcriptional silencing of unspliced HAC1 mRNA. DiSanto R, Aboulhouda S, Weinberg DE. Elife. 2016 Oct 1;5. pii: e20069. doi: 10.7554/eLife.20069. 10.7554/eLife.20069 PubMed 27692069