pMyCA-mCherry
(Plasmid
#84272)
-
PurposemCherry fluorescence protein expression using M. smegmatis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMyCA
- Backbone size w/o insert (bp) 5994
- Total vector size (bp) 6684
-
Vector typeBacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression using M.smegmatis
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp
-
Insert Size (bp)708
- Promoter Acetamidase
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgagaacctgtacttccagggcatggtgagcaagggcgag
- 3′ sequencing primer gcctggcagtcgatcgtacgttacttgtacagctcgtcc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMyCA-mCherry was a gift from Young-Hwa Song (Addgene plasmid # 84272 ; http://n2t.net/addgene:84272 ; RRID:Addgene_84272) -
For your References section:
A versatile vector for mycobacterial protein production with a functional minimized acetamidase regulon. Magana Vergara C, Kallenberg CJL, Rogasch M, Hubner CG, Song YH. Protein Sci. 2017 Aug 31. doi: 10.1002/pro.3288. 10.1002/pro.3288 PubMed 28857325