pJEP225-Lenti-CMV-Flag-GluN2A-WPRE-pA
(Plasmid
#84274)
-
PurposepLenti vector backbone designed to express Flag-GluN2A from a CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePlenti-7.3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3475
- Total vector size (bp) 11161
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFlag-GluN2A
-
Insert Size (bp)7686
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (unknown if destroyed)
- 3′ cloning site Blp1 (unknown if destroyed)
- 5′ sequencing primer tagtagacataatagcaacag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP225-Lenti-CMV-Flag-GluN2A-WPRE-pA was a gift from Jonathan Ploski (Addgene plasmid # 84274 ; http://n2t.net/addgene:84274 ; RRID:Addgene_84274) -
For your References section:
The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710