Skip to main content

pLdCH
(Plasmid #84291)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84291 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 84291-D50 50 μg of DNA in Tris buffer $495
DNA 84291-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSP72
  • Total vector size (bp) 9358
  • Vector type
    CRISPR ; Leishmania
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and Cas9
  • gRNA/shRNA sequence
    new gRNA guide
  • Species
    Leishmania
  • Promoter L. donovani ribosome RNA promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs I (not destroyed)
  • 3′ cloning site Bbs I (not destroyed)
  • 5′ sequencing primer CATATGTGAGTTATGAGGTCTGCGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pX330-U6-Chimeric_BB- CBh-hSpCas9 Obtained from Brodt Institute (through Addgene)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This Leishmania CRISPR vector co-express gRNA and Cas9 with Hygromycin resistance. It can also be used to express dual, triple or more gRNAs simultaneously with Cas9.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLdCH was a gift from Greg Matlashewski (Addgene plasmid # 84291 ; http://n2t.net/addgene:84291 ; RRID:Addgene_84291)
  • For your References section:

    Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. Zhang WW, Lypaczewski P, Matlashewski G. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. mSphere00340-16 [pii] PubMed 28124028