Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #63555)


Item Catalog # Description Quantity Price (USD)
Plasmid 63555 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5747
  • Total vector size (bp) 10112
  • Vector type
    Leishmania Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Humanized Streptococcus pyogenes Cas9 from PX330 (Addgene)
  • Alt name
  • Species
    Streptococcus pyogenes
  • Tag / Fusion Protein
    • flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer aagcttagcacctgcctgaaatcact
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Humanized Streptococcus pyogenes Cas9 gene was derived from pX330 plasmid distributed by Addgene ( Dr Feng Zhang, Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPhygCAS9 was a gift from Greg Matlashewski (Addgene plasmid # 63555 ; ; RRID:Addgene_63555)
  • For your References section:

    CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. Zhang WW, Matlashewski G. MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15. 10.1128/mBio.00861-15 PubMed 26199327