pLPhygCAS9
(Plasmid
#63555)
-
PurposeExpresses CAS9 in Leishmania
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLPHyg2
- Backbone size w/o insert (bp) 5747
- Total vector size (bp) 10112
-
Vector typeLeishmania Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHumanized Streptococcus pyogenes Cas9 from PX330 (Addgene)
-
Alt nameCAS9
-
SpeciesStreptococcus pyogenes
-
Tag
/ Fusion Protein
- flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer aagcttagcacctgcctgaaatcact (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Humanized Streptococcus pyogenes Cas9 gene was derived from pX330 plasmid distributed by Addgene ( Dr Feng Zhang, Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPhygCAS9 was a gift from Greg Matlashewski (Addgene plasmid # 63555 ; http://n2t.net/addgene:63555 ; RRID:Addgene_63555) -
For your References section:
CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. Zhang WW, Matlashewski G. MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15. 10.1128/mBio.00861-15 PubMed 26199327