Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84350)


Item Catalog # Description Quantity Price (USD)
Plasmid 84350 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6570
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    Huntingtin Exon 1
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter T7
  • Tag / Fusion Protein
    • N-terminal Ssp intein (His-tagged)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTWIN1-His6-Ssp-Httex1-29Q was a gift from Hilal Lashuel (Addgene plasmid # 84350 ; ; RRID:Addgene_84350)
  • For your References section:

    An Intein-based Strategy for the Production of Tag-free Huntingtin Exon 1 Proteins Enables New Insights into the Polyglutamine Dependence of Httex1 Aggregation and Fibril Formation. Vieweg S, Ansaloni A, Wang ZM, Warner JB, Lashuel HA. J Biol Chem. 2016 Jun 3;291(23):12074-86. doi: 10.1074/jbc.M116.713982. Epub 2016 Mar 21. 10.1074/jbc.M116.713982 PubMed 27002149