Skip to main content

pTWIN1-His6-Ssp-Httex1-43Q
(Plasmid #84352)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84352 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTWIN1
  • Backbone manufacturer
    eBioLabs
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6620
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Huntingtin Exon 1
  • Alt name
    Httex1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    820
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter T7
  • Tag / Fusion Protein
    • N-terminal Ssp intein (His-tagged)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTWIN1-His6-Ssp-Httex1-43Q was a gift from Hilal Lashuel (Addgene plasmid # 84352 ; http://n2t.net/addgene:84352 ; RRID:Addgene_84352)
  • For your References section:

    An Intein-based Strategy for the Production of Tag-free Huntingtin Exon 1 Proteins Enables New Insights into the Polyglutamine Dependence of Httex1 Aggregation and Fibril Formation. Vieweg S, Ansaloni A, Wang ZM, Warner JB, Lashuel HA. J Biol Chem. 2016 Jun 3;291(23):12074-86. doi: 10.1074/jbc.M116.713982. Epub 2016 Mar 21. 10.1074/jbc.M116.713982 PubMed 27002149