Skip to main content

mCyRFP1-RhoA
(Plasmid #84358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84358 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCyRFP1-RhoA
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1305
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCyRFP1 N terminal fusion to RhoA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgtaacaactccgccccatt
  • 3′ sequencing primer GCAAGTAAAACCTCTACAAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCyRFP1-RhoA was a gift from Ryohei Yasuda (Addgene plasmid # 84358 ; http://n2t.net/addgene:84358 ; RRID:Addgene_84358)
  • For your References section:

    Simultaneous dual-color fluorescence lifetime imaging with novel red-shifted fluorescent proteins. Laviv T, Kim BB, Chu J, Lam AJ, Lin MZ, Yasuda R. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4046. 10.1038/nmeth.4046 PubMed 27798609