pAd-Track Control siRNA
(Plasmid
#8437)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAd-Track
- Backbone size (bp) 8320
-
Modifications to backbonePoint mutation in SIRT1 siRNA
-
Vector typeMammalian Expression, Adenoviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameControl siRNA
-
Insert Size (bp)200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer No (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: GATGAAGTCGACCTCCTCAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd-Track Control siRNA was a gift from Pere Puigserver (Addgene plasmid # 8437 ; http://n2t.net/addgene:8437 ; RRID:Addgene_8437) -
For your References section:
Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P. Nature 2005 Mar 3;434(7029):113-8. 10.1038/nature03354 PubMed 15744310