Skip to main content

pSF4 CMV intron renilla TRICK CTE polyA
(Plasmid #84443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84443 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSF4
  • Vector type
    Mammalian Expression, Luciferase ; FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Renill-TRICK
  • Species
    Synthetic
  • Insert Size (bp)
    1737
  • Promoter Tet-CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer Cgagacagagaagactcttgc
  • 3′ sequencing primer ggttacaaataaggcaatagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSF4 CMV intron renilla TRICK CTE polyA was a gift from Jeffrey Chao (Addgene plasmid # 84443 ; http://n2t.net/addgene:84443 ; RRID:Addgene_84443)
  • For your References section:

    Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328