Skip to main content

pTH2
(Plasmid #84452)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84452 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCM29
  • Backbone size w/o insert (bp) 6604
  • Total vector size (bp) 6580
  • Modifications to backbone
    sGFP replaced with insert
  • Vector type
    shuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
  • Selectable markers
    also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10F
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFP Cerulean
  • Insert Size (bp)
    737

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site kpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTGCATGCCTGCAGGTCGACTCTA
  • 3′ sequencing primer TTATGCTTCCGGCTCGTATGTTGTGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CFP/Cerulean amplified from pJL76; Liese J, Rooijakkers SHM, van Strijp JAG, Novick RP, Dustin ML. 2013. Intravital two-photon microscopy of host–pathogen interactions in a mouse model of Staphylococcus aureus skin abscess formation. Cellular microbiology 15:891.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTH2 was a gift from Reindert Nijland (Addgene plasmid # 84452 ; http://n2t.net/addgene:84452 ; RRID:Addgene_84452)
  • For your References section:

    Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573
Commonly requested with: