pJB38-NWMN2930
(Plasmid
#84457)
-
PurposepJB38 plasmid containing the S.aureus Newman genetic region between genes 29 and 30
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJB38
- Backbone size w/o insert (bp) 7015
- Total vector size (bp) 8815
-
Selectable markersalso contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10F
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStaphylococcus aureus NWMN genomic region NWMN29-30
-
SpeciesStaphylocccus aureus
-
GenBank IDNC_009641.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer AACCTATAAAAATAGGCGTATCA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB38-NWMN2930 was a gift from Reindert Nijland (Addgene plasmid # 84457 ; http://n2t.net/addgene:84457 ; RRID:Addgene_84457) -
For your References section:
Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573