pEGFP-PH-SWAP70(R223E, R224E)
(Plasmid
#84583)
-
PurposeExpresses GFP-tagged PH-domain of SWAP70 in mammalian cells, impaired phosphoinositide binding
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSWAP70 residues 209-306 with mutations R223E and R224E
-
Alt nameSWP70, KIAA0640, HSPC321
-
SpeciesH. sapiens (human)
-
Insert Size (bp)310
-
MutationPleckstrin-homology domain, residues 209-306, mutations R223E and R224E
-
GenBank IDNM_001297714.1
-
Entrez GeneSWAP70 (a.k.a. HSPC321, SWAP-70)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCCGCCGGGATCAC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-PH-SWAP70(R223E, R224E) was a gift from Geert van den Bogaart (Addgene plasmid # 84583 ; http://n2t.net/addgene:84583 ; RRID:Addgene_84583) -
For your References section:
SWAP70 Organizes the Actin Cytoskeleton and Is Essential for Phagocytosis. Baranov MV, Revelo NH, Dingjan I, Maraspini R, Ter Beest M, Honigmann A, van den Bogaart G. Cell Rep. 2016 Nov 1;17(6):1518-1531. doi: 10.1016/j.celrep.2016.10.021. 10.1016/j.celrep.2016.10.021 PubMed 27806292