delta NT delta CT p70S6K1 MSCV puro
(Plasmid
#8463)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonemscv puro
-
Backbone manufacturerbd biosciences
- Backbone size w/o insert (bp) 6300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedelta NT delta CT p70 S6K1
-
Alt namep70S6K1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1050
-
Mutationp70 s6k1 form
-
Entrez GeneRps6kb1 (a.k.a. p70 S6K-alpha)
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site sal (not destroyed)
- 3′ cloning site not (not destroyed)
- 5′ sequencing primer MSCV (CCCTTGAACCTCCTCGTTCGACC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byjoe avruch
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
delta NT delta CT p70S6K1 MSCV puro was a gift from David Sabatini (Addgene plasmid # 8463 ; http://n2t.net/addgene:8463 ; RRID:Addgene_8463) -
For your References section:
Structure of S6K1 determines if raptor-mTOR or rictor-mTOR phosphorylates its hydrophobic motif site. Ali SM, Sabatini DM. J Biol Chem 2005 Apr 4;. 10.1074/jbc.C500125200 PubMed 15809305